Electroporation and rna interference in the rodent retina. The mouse fgf8b coding region without stop codon was subcloned into the ecori site of a pegfpn1 vector to obtain pcmvfgf8begfpan. A pair of primers was designed representing the two ends of the. Histone chromobodyegfp plasmid 1 version 20170728 the plasmid map has been compiled using the information from sequence databases, published literature, and other sources, together with partial sequences. Department of anatomical sciences, faculty of medicine. Nterminal flagtagged drd2 was cloned as described 39, with some modifications. Excitation maximum 488 rtm, emission maxumum 507 nm. Tokue is a global leader in biotechnology innovation, offering great benefits and applications to the biopharmaceutical and diagnostic industries as well as for biotechnology research communities. Egfp f64l, s65t was then amplified by pcr from pegfpn1 clontech and ligated into the nhe i sal i gap of pciebfp to construct the pgdb. Rbpj pegfpn1 two fragments encoding rbpj were ligated into pegfpn1 clontech digested with ecorixmai blunted.
Several of the probes had a 355 amino acid iband section of titin, i. Not1digested pegfp n1 mammalian expression vector making use of t4 dna ligase. Prostate cancer transfection by acoustic energy using pegfp. Constructionofa eukaryotic expressionvector for pegfpfst and. The human pgk promoter and puromycin resistance gene sequences were ampli. Dishevelled limits notch signalling through inhibition of csl. The product was digested with ecori and pmei and subcloned into a modified ptraceref vector invitrogen. The cdcrel1 coding sequence was fused to the egfp orf within pegfpn1 clontech, and the fragment encoding the fusion protein was subsequently transferred to psubpdgfwpre. Vector for fusing egfp to the cterminus of a partner protein. Clontech, and the resulting plasmid was further confirmed by restriction digestion.
For other reading frames, use pegfp n2 or pegfp n3. Chicken embryo fibroblasts were transfected and expressed the reporter gene. Induction of tumor immunity and cytotoxic t lymphocyte. Tbusa, formerly known as clontech laboratories, inc. Ebfp f64l, s65t, y66h was amplified by pcr from pebfp clontech and ligated into the salinoti sites of pcineo promega to construct pciebfp. Expression and evolution of the mammalian brain gene ttyh1. Electroporation and rna interference in the rodent retina in. Green fluorescent protein an overview sciencedirect topics. Producing a mammalian gfp expression vector containing. Bcl i sites are methylated in the dna provided by bd biosciences clontech. Takara bio provides kits, reagents, and services that help researchers explore questions about gene discovery, regulation, and function.
Construction of a eukaryotic expression vector for pegfpfst and its biological activity in duck myoblasts xinxin li, jiwen wang. Welcome to vector database vector database is a digital collection of vector backbones assembled from publications and commercially available sources. The mrfp1 coding region without stop codon and the cdna fragment. They may not be used for any other purpose, including, but not limited to, use in drugs, in vitro. Detection of programmed cell death using fluorescence energy. Prostate cancer transfection by acoustic energy using. N and c are, as you thought the nterminal and cterminal tags, often it is a bit counterintuitive for these though, for example in the pegfp c1 plasmid, if you clone into this, the gfp will be nterminal to the insert i.
Monitoring transfected cells without selection agents by. Clontech products are to be used for research purposes only. Tumors were treated by acoustic energy with different parameter settings and the transfection. Restriction map and multiple cloning site mcs of pegfpn1 vector. The final pcr product and pegfpn1 plasmid were each digested with nhei and bamhi both, mbi, st.
The mixture was then transferred to a 2mm electroporation cuvette and electroporated on the maximum efficiency setting. Detection of programmed cell death using fluorescence. Arrow above devd points to cpp32 protease cleavage site. Hightiter, helper virusfree raav2 were generated with plasmid pdg 25 and purified as. Restriction map and multiple cloning site mcs of pegfp c1. The bamhinotidigested fragment encoding gfprip3 n223 or gfprip3 was subcloned into.
Transfection and selection data related to pegfp c1 in cellculture. Human drd2longisoform was cloned inegfpn1 clontech, mountain view, ca, usa as previously described 38. Construction of the mammalian expressing vector pegfpn1p53. The cells were resuspended in 100 l of the nucleofector solution containing the plasmid. This is a free resource for the scientific community that is compiled by addgene this page is informational only this vector is not available from addgene please contact the manufacturer for further details. The s58n dominant negative mutant of cdcrel1 is cloned into pegfpn1 in a similar manner except the mutant version of cdcrel.
Targeting of cardiac muscle titin fragments to zbands and. This vector was then subjected to colonypcr as well as dna sequencing for the accurate assessment of the subcloning processes. Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. Functional expression of dopamine d2 receptor is regulated.
Keywords pegfpn1 source synthetic dna construct organism synthetic dna construct reference 1 bases 1 to 4733 authors clontech title direct submission comment features locationqualifiers source 14733 organismsynthetic dna. Construction of recombinant pegfpn1hper2 plasmid and its. Vector type mammalian expression vector, pegfpn1 clontech backbone. Constructionofa eukaryotic expressionvector for pegfpfst. For construction of pcmvgfp, pefgfp, and pubgfp, the promoter region of pcaggfp was replaced by the cytomegalovirus cmv promoter excised from pegfpn1, the human elongation factor ef 1. This fragment was cloned into the bamhi and nari sites of pgem4z promega, along with oligonucleotides containing a noti halfsite, the pgem4z polylinker sequence from bamhi to ecori, 64 at bp, anspei site, and a nari halfsite to create pgem4zgfpa64. The plasmid pegfpn1, encoding enhanced green fluorescent protein egfp controlled by the cytomegalovirus cmv promoter clontech, was used as a source of the coding sequence of the pgreen minigene. Fulllength drd2 coding sequence was amplified by pcr and subcloned into pdsredn1 clontech. Stable transfection of pegfpn1mog plasmid to utilize in. They may not be used for any other purpose, including, but. The xba i and bcl i sites are methylated in the dna provided by bd biosciences clontech.
The pegfpn1p53 vector was constructed successfully and could be. The numbers of myoblasts in both the pegfp n1 and controls group were significantly lower than in the pegfp fst group, with only a few cells fusing into myotubes, as shown in fig. Our mission is to develop highquality innovative tools and services to accelerate discovery. Other probes were to designed with the zrepeat separated from gfp by 17 amino acids in the. A clone without pcr errors was selected for use as a mammalian ttyh1gfp expression vector and named pegfpn1ttyh1. For constructing pubic and pr26, the ubic and r26 promoters were amplified from pubicegfpn1 and pr26egfpn1, respectively, by using oligonucleotide primers containing a bglii or sali linker for each end. So that if it is not spliced, the gfp will not express because of the the stop codon. Construction of a eukaryotic expression vector for pegfp.
Ligation after confirmation, the mog gene was prepared to be ligated to expression vector. The xba i site is methylated in the dna provided by clontech. If you wish to digest the vector with these enzymes, you will need to transform the vector into a dam host and make fresh dna. Bamhi, and ligated between the ecori and bamhi sites of pegfpn1 clontech. We have precisely monitored the cells transfected with this vector on our custom culture dishes, thereby bypassing the need for selection agent or fluorescent cell sorting. Theseresults provide technical support for basic research on the regulation of fst in skeletal muscle electronic journal of biotechnology 17 2014 224229. Priority date the priority date is an assumption and is not a legal conclusion. Clontech and ligated into the xhoi and noti sites of pegfpn1. Oof 1 constructionofa eukaryotic expressionvector for pegfpfst and its biologicalactivity 2 in duck myoblasts 3q1 xinxin li, jiwen wang. The fragments were subcloned into pegfpn1 orc1 to generate the probes in figure 3. Dopaminedependent neurodegeneration in rats induced by. Fst and the multiple cloning sites present in the pegfpn1 vector clontech, ca, usa, xho i and ecori were chosen as the insertion sites. Provide pegfp n1 vectorplasmid map, full length sequence, antibiotic resistance, size and other information. Construction of the pegfpn1p53mar vector and its effect.
The pgreen minigene was subsequently amplified using. Dopaminedependent neurodegeneration in rats induced by viral. As a positive control the egfp fragment of the pegfpn1. Construction of a eukaryotic expression vector pegfpc1bmp2. Bamhinoti fragment from pegfpn1 clontech, cambridge, uk into bamhi and noti digested pires1hyg clontech, cambridge, uk. The pegfp n1 p53 vector was constructed successfully and could be. Subcutaneous implantation of dunning tumors was followed by injection of pegfp dna plasmid. Restriction map and multiple cloning site mcs of pegfpc1. The cdcrel1 cdna is then excised from the pbluescript ks using hindiii and psti in an orientation of 5. The fragments coding for bclrambo n204 or amino acid residues 156 from smacdiablo were digested and inserted into ecorisali sites of pegfpc1 or bgliixhoi sites of pegfpn1 clontech, respectively. This page is informational only this vector is not available from addgene please contact the manufacturer for further details. This project is supported bytokuewhich specializes in manufacturing ultrapure antibiotics for a broad spectrum of biotechnology applications as well as for the pharmaceutical industry. Flagprmt8 was generatedbypcrwiththeprimers5 catgaattcatgggcatgaaa cactcc3 and5 taagtttaaacttaacgcattttgtag tca tt3. Subcutaneous implantation of dunning tumors was followed by injection of pegfpdna plasmid.
Construction of a eukaryotic expression vector for pegfpfst. If you wish to digest the vector with these enzymes, you will. Pallial origin of basal forebrain cholinergic neurons in. This is a free resource for the scientific community that is compiled by addgene. Construction of the pegfpn1p53mar vector and its effect on. Construction of a eukaryotic expression vector pegfpc1. Construction of the mammalian expressing vector pegfpn1. Construction of a plasmid coding for green fluorescent protein.
Egfp f64l, s65t was then amplified by pcr from pegfpn1 clontech and ligated into the nheisali gap of pciebfp to construct the pgdb. Interestingly, the migration of cells transfected with pegfpc1bmp2 plasmid was significantly increased at 36 and 48 h compared with the control group and the pegfpc1 group p c1. The modified ptraceref vector contains a kozak sequence, and atg start codon. N and c are, as you thought the nterminal and cterminal tags, often it is a bit counterintuitive for these though, for example in the pegfpc1 plasmid, if you clone into this, the gfp will be nterminal to the insert i.
1084 926 1138 68 221 815 94 281 1386 1358 1388 42 850 804 1072 843 379 557 919 1440 229 36 1570 650 1545 1180 1402 580 759 1171 774 1360 674 72 1076 97 1302 930 399 1179 791